View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5005_high_12 (Length: 294)
Name: NF5005_high_12
Description: NF5005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5005_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 37642885 - 37642663
Alignment:
| Q |
19 |
ataaaagaccgtgtatcaaactttaatgcaccaaagttcatggataagccacattaggttaaatcagttttatgattttaatgctttctaatattctatc |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37642885 |
ataaaagaccgtgtatcaaactccaatgcaccaaagttcatggataagccgcattaggttaaatcagttttatgattttaatgctttctaatattctatc |
37642786 |
T |
|
| Q |
119 |
atagtgacacacaattattagctaa----------------accgcgctcatggtgtttctttcggtcatcggttgggcacataaagtatgacataagct |
202 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37642785 |
atagtgacacacaattattagctaaaccaacatagccttctaccgcgctcatggtgtttctttcgctcatcggttgggcacataaagtatgacataagct |
37642686 |
T |
|
| Q |
203 |
ttttggcacctttaaattaagaa |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37642685 |
ttttggcacctttaaattaagaa |
37642663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University