View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5005_low_14 (Length: 273)
Name: NF5005_low_14
Description: NF5005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5005_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 165
Target Start/End: Original strand, 35891562 - 35891708
Alignment:
| Q |
18 |
atatccaaaataagacaaccttgcatgaagggaatatatgtagnnnnnnnnntcaacatgatataagtataacattaggggttgaggtttgaattgcgaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||| ||||||||||| || |
|
|
| T |
35891562 |
atatccaaaataagacaaccttgcatgaagggaatatatgtagaaaaaaaa-tcaacatgatataagtataacagtgagggttgaagtttgaattgcaaa |
35891660 |
T |
 |
| Q |
118 |
caccctacttatttattnnnnnnngattaatttttagcatagactact |
165 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35891661 |
caccctacttatttattaaaaaaagattaatttttagcatagactact |
35891708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University