View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5005_low_14 (Length: 273)

Name: NF5005_low_14
Description: NF5005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5005_low_14
NF5005_low_14
[»] chr8 (1 HSPs)
chr8 (18-165)||(35891562-35891708)


Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 165
Target Start/End: Original strand, 35891562 - 35891708
Alignment:
18 atatccaaaataagacaaccttgcatgaagggaatatatgtagnnnnnnnnntcaacatgatataagtataacattaggggttgaggtttgaattgcgaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||| |  ||||||| ||||||||||| ||    
35891562 atatccaaaataagacaaccttgcatgaagggaatatatgtagaaaaaaaa-tcaacatgatataagtataacagtgagggttgaagtttgaattgcaaa 35891660  T
118 caccctacttatttattnnnnnnngattaatttttagcatagactact 165  Q
    |||||||||||||||||       ||||||||||||||||||||||||    
35891661 caccctacttatttattaaaaaaagattaatttttagcatagactact 35891708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University