View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5005_low_15 (Length: 264)
Name: NF5005_low_15
Description: NF5005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5005_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 33813557 - 33813328
Alignment:
| Q |
19 |
atgatgaagaggaagaaccagaagaatcatttaaataagaagaggaaccaccaaaaaccatggttgggttggtttgaaccatatcacaaggaattgcact |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33813557 |
atgatgaagaggaagaaccggaagaatcatttaaacaagaagaggaaccaccaaaaaccatggttgggttggtttgaaccatatcacaaggaattgcact |
33813458 |
T |
|
| Q |
119 |
tgcaccatcgttaacaacttgctgaggctgcatcatagccatctgatttctttgctgatcaagtgtggcctgctgcatctggcgttgtcggcggcgagat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33813457 |
tgcaccatcgttaacaacttgctgaggctgcatcatagccatctgatttctttgctgatcaagtgtggcctgctgcatctggcgttgtcggcggcgagat |
33813358 |
T |
|
| Q |
219 |
ctagaccggcggttttggaaccagtagaag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33813357 |
ctagaccggcggttttggaaccagtagaag |
33813328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University