View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5005_low_23 (Length: 208)
Name: NF5005_low_23
Description: NF5005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5005_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 7781711 - 7781641
Alignment:
| Q |
18 |
tacttctgactattcgattctccagtatttaggatcttgaggtttgagcatcatagatgtgtatcaatttc |
88 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7781711 |
tacttctgactattagattctcaagtatttaggatcttgaggtttgagcatcatagatgtgtatcaatttc |
7781641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 162
Target Start/End: Complemental strand, 7781631 - 7781595
Alignment:
| Q |
126 |
tttggaaattaggattctaacaagaaatagaggagaa |
162 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
7781631 |
tttggaaattaggattctgacaagaaatacaggagaa |
7781595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University