View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5005_low_5 (Length: 425)
Name: NF5005_low_5
Description: NF5005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5005_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 8382738 - 8382507
Alignment:
| Q |
17 |
attatcagccaagaagagaatgaggttggctttgtgttgaggaatctctgatcggaacttctcaaaaacagaatcaaagtttgaaactgttgaggtaaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8382738 |
attatcagccaagaagagaatgaggttggctttgtgttgaggaatctctgatcggaacttctcaaaaacagaatcaaagtttgaaactgttgaggtaaac |
8382639 |
T |
|
| Q |
117 |
accttcaacgtcattcttcacttctttctgcaaataaacgctatctcaatctcgcagattcgggtttgtgaatatgataaagaatatgatacgaacaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | ||| ||||||| |
|
|
| T |
8382638 |
accttcaacgtcattcttcacttctttctgcaaataaacgctatctcaatctcgcagattcgggtttgtgaatatgatacgaacttggctacaaacaagg |
8382539 |
T |
|
| Q |
217 |
gttatataggaaataaataattggtttatttc |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
8382538 |
gttatataggaaataaataattgatttatttc |
8382507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 337 - 417
Target Start/End: Complemental strand, 8382415 - 8382335
Alignment:
| Q |
337 |
aagtttgcaaaaatatatgccacacattgtgttcttattcgatttgttggattagtctcttcagttatgcacagtataatc |
417 |
Q |
| |
|
||||||||||||||||||| || |||||||||| | ||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
8382415 |
aagtttgcaaaaatatatgttactaattgtgttctcactcgatttgttggattagtctcttcaattatgcacggtataatc |
8382335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University