View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5006-Insertion-10 (Length: 110)
Name: NF5006-Insertion-10
Description: NF5006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5006-Insertion-10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 11 - 110
Target Start/End: Original strand, 32803640 - 32803739
Alignment:
| Q |
11 |
actacattgttctgcaccacgtcgttccagataaacttgtaaagcagcacatcgcgacgaaagagccaatgatggtcttcgaaatcaccgataaggttca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32803640 |
actacattgttctgcaccacgtcgttccagataaacttgtaaggcaccacatcacgacgaaagagccaatgatggtcttcgaaatcaccgataagattca |
32803739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University