View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5006-Insertion-8 (Length: 57)
Name: NF5006-Insertion-8
Description: NF5006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5006-Insertion-8 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
| [»] scaffold0061 (1 HSPs) |
| | |
|
| [»] scaffold0017 (2 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 1e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 6 - 57
Target Start/End: Original strand, 8342807 - 8342858
Alignment:
| Q |
6 |
cagaaactcttttgaaggcaccctctctgaatcccatttcactaacctctca |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8342807 |
cagaaactcttttgaaggcaccctctctgaatcccatttcactaacctctca |
8342858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 9 - 57
Target Start/End: Original strand, 26728475 - 26728523
Alignment:
| Q |
9 |
aaactcttttgaaggcaccctctctgaatcccatttcactaacctctca |
57 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
26728475 |
aaactcttttgaaggtgtcgtctctgaatcccatttcactaacctctca |
26728523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000001; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 11544277 - 11544229
Alignment:
| Q |
8 |
gaaactcttttgaaggcaccctctctgaatcccatttcactaacctctc |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11544277 |
gaaactcttttgaaggcattgtctctgaatcccatttcactaacctctc |
11544229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 44612928 - 44612976
Alignment:
| Q |
8 |
gaaactcttttgaaggcaccctctctgaatcccatttcactaacctctc |
56 |
Q |
| |
|
|||||||||||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
44612928 |
gaaactcttttgaaggtatcatctctgaatcccatttcactaacctctc |
44612976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 29 - 56
Target Start/End: Original strand, 44145659 - 44145686
Alignment:
| Q |
29 |
tctctgaatcccatttcactaacctctc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44145659 |
tctctgaatcccatttcactaacctctc |
44145686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 33; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 29057 - 29009
Alignment:
| Q |
8 |
gaaactcttttgaaggcaccctctctgaatcccatttcactaacctctc |
56 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
29057 |
gaaactcttttgaaggtgtcgtctctgaatcccatttcactaacctctc |
29009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 33; Significance: 0.0000000002; HSPs: 2)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 169735 - 169783
Alignment:
| Q |
8 |
gaaactcttttgaaggcaccctctctgaatcccatttcactaacctctc |
56 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
169735 |
gaaactcttttgaaggtgtcgtctctgaatcccatttcactaacctctc |
169783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017; HSP #2
Raw Score: 27; E-Value: 0.0000009
Query Start/End: Original strand, 6 - 56
Target Start/End: Original strand, 174639 - 174689
Alignment:
| Q |
6 |
cagaaactcttttgaaggcaccctctctgaatcccatttcactaacctctc |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
174639 |
cagaaactcttttgaaggtgttgtctctgaatcgcatttcactaacctctc |
174689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University