View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5006_high_15 (Length: 269)
Name: NF5006_high_15
Description: NF5006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5006_high_15 |
 |  |
|
| [»] scaffold1064 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0185 (1 HSPs) |
 |  |  |
|
| [»] scaffold1114 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1064 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: scaffold1064
Description:
Target: scaffold1064; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 1375 - 1112
Alignment:
| Q |
1 |
tttgatggccctctcactagcaatgatcttaaatagacagagatctgagacatacaacatagggttagcggcgactttttggttcttccttaatcggtac |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1375 |
tttgatggccctctcaccagcaatgatcttaaatagacagagatctgaaacatacaacatagggttagcggcgactttttggttcttccttaatcggtac |
1276 |
T |
 |
| Q |
101 |
atttatgtttcaaattctcttcatattcaaatgggaagaacagagagagtttgtcgtgtacaatgtattggaaatcatagcctcttatagtgtgatggtc |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1275 |
atttatgtttcaagttctcttcatattcaaatgggaagaacagagagagtttgtcgtgtacaatgtattggaaatcatagtctcttatagtgtgatggtc |
1176 |
T |
 |
| Q |
201 |
attaaggtttctattatcccgttaattggtcgtccagacatccattcgtagggttcatctcact |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||| ||| || ||| ||||| |
|
|
| T |
1175 |
attaaggtttctattatcccgttaattggtcgtctagacatctattcatagagtccatatcact |
1112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 9237376 - 9237146
Alignment:
| Q |
1 |
tttgatggccctctcactagcaatgatcttaaatagacagagatctgagacatacaacatagggttagcggcgactttttggttcttccttaatcggtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
9237376 |
tttgatggccctctcactagcaatgatcttaaatagacagagatctgaaacatacaacatagggttagcggcgaccttttggttctt-----------ac |
9237288 |
T |
 |
| Q |
101 |
atttatgtttcaaattctcttcatattcaaatgggaagaacagagagagtttgtcgtgtacaatgtattggaaatcatagcctcttatagtgtgatggtc |
200 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9237287 |
atttatgtttcaagttctctttagattcaaatgggaagaacaaagag--tttgtcgtgtacaatgtattgggaatcatagcctcttatagtgtgatggtc |
9237190 |
T |
 |
| Q |
201 |
attaaggtttctattatcccgttaattggtcgtccagacatcca |
244 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
9237189 |
attaaggtttccattatcccgttaattggtcatccagacatcca |
9237146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 142 - 212
Target Start/End: Original strand, 33458201 - 33458271
Alignment:
| Q |
142 |
agagagagtttgtcgtgtacaatgtattggaaatcatagcctcttatagtgtgatggtcattaaggtttct |
212 |
Q |
| |
|
|||||||||||| ||||| | ||||||| |||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
33458201 |
agagagagtttgccgtgtctagtgtattgaaaatcatagcctcttatagtattatggtcattagggtttct |
33458271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 59 - 123
Target Start/End: Complemental strand, 31057989 - 31057924
Alignment:
| Q |
59 |
atagggttagcggcgactt-tttggttcttccttaatcggtacatttatgtttcaaattctcttca |
123 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| |||||| |||||| |||| ||||||||| |
|
|
| T |
31057989 |
atagagttagcggcgactgatttggttcttccttaaccggtacctttatgcctcaagttctcttca |
31057924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 244
Target Start/End: Complemental strand, 38272 - 38191
Alignment:
| Q |
164 |
tgtattggaaatcatagcctcttatagtgtgatggtcattaagg-tttctattatcccgttaattggtcgtccagacatcca |
244 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||| |||||| || |||||||||| |||||||| |||| || ||||||||| |
|
|
| T |
38272 |
tgtattggagaccataacctcttatagtgtgatgatcattagggttttctattattccgttaatcggtcatctagacatcca |
38191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0185 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0185
Description:
Target: scaffold0185; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 107
Target Start/End: Complemental strand, 5894 - 5840
Alignment:
| Q |
54 |
acaacatagggttagcggcgactt-tttggttcttccttaatcggtacatttatg |
107 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
5894 |
acaacatagggttagcgacgactaatttggttcttcctcaaccggtacatttatg |
5840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 78 - 123
Target Start/End: Complemental strand, 20500063 - 20500018
Alignment:
| Q |
78 |
tttggttcttccttaatcggtacatttatgtttcaaattctcttca |
123 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| ||||||||| |
|
|
| T |
20500063 |
tttggttcttccttaaccggtacatttatgcctcaagttctcttca |
20500018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1114 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1114
Description:
Target: scaffold1114; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 142 - 186
Target Start/End: Complemental strand, 931 - 887
Alignment:
| Q |
142 |
agagagagtttgtcgtgtacaatgtattggaaatcatagcctctt |
186 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
931 |
agagagagtttgtcgtgtacagtgtattggggaccatagcctctt |
887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University