View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5006_high_24 (Length: 227)
Name: NF5006_high_24
Description: NF5006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5006_high_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 23679048 - 23679274
Alignment:
| Q |
6 |
agcttctgtgaaactttcggtccatccttgattattggatgaactctaccatagg-------------agtttagtcttgatagaggaaaaaagaaacaa |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23679048 |
agcttctgtgaaactttcggtccatccttgattattggatgaactctaccatagtgattgaattaaaaagtttagtcttgatagaggaaaaaagaaacaa |
23679147 |
T |
 |
| Q |
93 |
agaaacaatgactttccctccctgtannnnnnnnccttgtgagataagtttgtctcattcttttgtagcttatggtttattaattcattttgtagaaaaa |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23679148 |
--------tgactttccctccctgtattttttttccttgtgagataagtttgtctcattcttttgtagcttatggtttattaattcattttgtagaaaaa |
23679239 |
T |
 |
| Q |
193 |
ttatacagaatttgacgtcaaaatttgtctgcaaa |
227 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||| |
|
|
| T |
23679240 |
ttagacagaatttgacgtcaaaatttgtttgcaaa |
23679274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University