View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5006_low_17 (Length: 250)
Name: NF5006_low_17
Description: NF5006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5006_low_17 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 10125267 - 10125031
Alignment:
| Q |
14 |
agacacgggtaactagttagtatgtaatattgtcgatacaatacaatgccatcgtgtcgttataactgctatttaacaaaactatgtactgcgtaacgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10125267 |
agacacgggtaactagttagtatgtaatatcgtcgatacaatacaatgccatcgtgtcgttataactgctatttaacaaaactatgtactgcgtaacgat |
10125168 |
T |
 |
| Q |
114 |
aacaaatttgtttaaatttcaccgcgttatagactctatttgacatggtaatatccttgatacagtagcatgctataacgcaaaatctgttcaattatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10125167 |
aacaaatttgtttaaatttcaccgcgttatagactctatttgacatggtaatatccttgatacagtagcatgctataacgcaaaatctgttcaattatat |
10125068 |
T |
 |
| Q |
214 |
agacattagtggcacacataaatcaccgcgttatagc |
250 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |
|
|
| T |
10125067 |
agacattagtggcacacataaatcactgtgttatagc |
10125031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 162 - 237
Target Start/End: Complemental strand, 10118494 - 10118419
Alignment:
| Q |
162 |
taatatccttgatacagtagcatgctataacgcaaaatctgttcaattatatagacattagtggcacacataaatc |
237 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||| |||| ||||||||||| |||| || |||||||||| |
|
|
| T |
10118494 |
taatatccttgatacaataacatgctataaagcaaaatatgtttgattatatagacgctagttgcgcacataaatc |
10118419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University