View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5006_low_19 (Length: 247)
Name: NF5006_low_19
Description: NF5006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5006_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 23679804 - 23680045
Alignment:
| Q |
1 |
attccaatattctttgggaaattcaaaatcaacggaaccaacaaagagaagctataaataatgtagttcagcaacatttgtaaatcaacgtttt-gaata |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
23679804 |
attccactattctttgggaaattcaaaatcaatggaaccaacaaagagaagctataaataatat--ttcagcaacatttgtaaatcaacgtttttgaata |
23679901 |
T |
|
| Q |
100 |
tgtgaaaacacatggacatatatatcatgccaatagacaaaacatctcttcattaaatattgaagatgatagaataggtacattacatgttatgttacaa |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23679902 |
tgtgaaaacacattgacatatatatcatgccaatagacaaaacatctcttcattaaatattgaagatgatagaataggtacattacatgttatgttacaa |
23680001 |
T |
|
| Q |
200 |
ttatacatttttcacgtcaggcacactattctcatattcttcga |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23680002 |
ttatacatttttcacgtcaggcacactattctcattttcttcga |
23680045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University