View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5006_low_4 (Length: 401)
Name: NF5006_low_4
Description: NF5006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5006_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 7172940 - 7173225
Alignment:
| Q |
1 |
taataacgagcttgtgatgacaactggtggaacccagaaagagtatgtggttgatgtttggtctgggaaccatccattttacctaggtaacaggtctgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7172940 |
taataacgagcttgtgatgacaactggtggaacccagaaagagtatgtggttgatgtttggtctgggaaccatccattttacctaggtaacaggtctgct |
7173039 |
T |
|
| Q |
101 |
cttatggtgagtgatgatcaggtggagaagtttcgtaagaagttcggtgaattgtcacagattatggagattcctgtgcttaaaggtgagattgttattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7173040 |
cttatggtgagtgatgatcaggtggagaagtttcgtaagaagttcggtgaattgtcacagattatggagattcctgtgcttaaaggtgagattgttattc |
7173139 |
T |
|
| Q |
201 |
cttctagacgtaaagggattaaaagtggtggagggaagaagaagtgagttatttgtgttggaattgtaatttgattgtatggtgtt |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7173140 |
cttctagacgtaaagggattaaaagtggtggagggaagaagaagtgagttatttgtgttggaattgtaatttgattgtatggtgtt |
7173225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University