View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5006_low_5 (Length: 388)

Name: NF5006_low_5
Description: NF5006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5006_low_5
NF5006_low_5
[»] chr7 (9 HSPs)
chr7 (19-373)||(25533839-25534191)
chr7 (19-177)||(25526031-25526189)
chr7 (23-137)||(25516226-25516341)
chr7 (49-140)||(25540605-25540697)
chr7 (196-249)||(31418966-31419019)
chr7 (203-249)||(21453181-21453227)
chr7 (203-249)||(12003331-12003377)
chr7 (213-249)||(6472699-6472735)
chr7 (19-101)||(25539539-25539621)
[»] chr8 (6 HSPs)
chr8 (202-250)||(1667822-1667870)
chr8 (202-250)||(16658527-16658575)
chr8 (198-250)||(33360100-33360152)
chr8 (198-247)||(42808382-42808429)
chr8 (203-235)||(32381211-32381243)
chr8 (203-235)||(32435166-32435198)
[»] chr3 (4 HSPs)
chr3 (202-250)||(2339178-2339226)
chr3 (206-248)||(9456119-9456161)
chr3 (203-249)||(52893141-52893187)
chr3 (197-245)||(40922552-40922600)
[»] chr5 (7 HSPs)
chr5 (203-250)||(21745033-21745080)
chr5 (203-250)||(42740888-42740935)
chr5 (203-249)||(32863333-32863379)
chr5 (203-251)||(3173848-3173895)
chr5 (201-249)||(26063041-26063089)
chr5 (203-249)||(18740036-18740081)
chr5 (205-249)||(43299937-43299980)
[»] scaffold0005 (1 HSPs)
scaffold0005 (197-249)||(39323-39375)
[»] chr4 (8 HSPs)
chr4 (197-249)||(14800352-14800404)
chr4 (201-252)||(33754312-33754363)
chr4 (198-248)||(21421920-21421970)
chr4 (203-249)||(46164751-46164797)
chr4 (203-251)||(44504331-44504379)
chr4 (203-249)||(8433371-8433416)
chr4 (201-234)||(20037990-20038023)
chr4 (203-249)||(54785574-54785622)
[»] chr2 (1 HSPs)
chr2 (207-251)||(38978988-38979032)
[»] chr6 (3 HSPs)
chr6 (203-249)||(16497560-16497606)
chr6 (197-250)||(7170715-7170768)
chr6 (203-249)||(14125098-14125143)
[»] chr1 (3 HSPs)
chr1 (203-247)||(26014217-26014261)
chr1 (201-249)||(18994625-18994673)
chr1 (203-249)||(26354696-26354741)
[»] scaffold1160 (1 HSPs)
scaffold1160 (203-246)||(2168-2211)


Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 9)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 19 - 373
Target Start/End: Complemental strand, 25534191 - 25533839
Alignment:
Q  19 atagttgcataggaaaggtacacattcagttacttggtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtacctttata 118  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25534191 atagttgcatagaaaaggtacacattcagttacttggtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtacctttata 25534092  T
Q  119 tacaaatatgttgttagaagcatttagacgcaacactgtatcaagtttggctattttgtgggataaacaggaagcatttaaataatggggtggtggtggc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  25534091 tacaaatatgttgttagaagcatttagacgcaacactgtatcaagtttggctattttgtgggataaacaggaagcatttaaataatggggtggcggtggc 25533992  T
Q  219 tcccccttgccaccccccagttccgccactgcaccaagcatgacccattttcaagactccacccttcctcgacccttcatctcttcaatgcctggccatt 318  Q
    ||||||||||||  |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  25533991 tcccccttgcca--ccccagttccgccactgcaccacgcatgacccattttcaagactccacccttcctcgaccctttatctcttcaatgcctggccatt 25533894  T
Q  319 aacaatacgctgcaatttgtttcgggaaacactaacaacactgagttattgtagc 373  Q
    ||||||| ||||||||||||||| ||||||| ||||||   ||||||||||||||    
T  25533893 aacaataagctgcaatttgtttctggaaacaataacaaacatgagttattgtagc 25533839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 19 - 177
Target Start/End: Complemental strand, 25526189 - 25526031
Alignment:
Q  19 atagttgcataggaaaggtacacattcagttacttggtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtacctttata 118  Q
    |||| |||||| |||| | ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  25526189 atagctgcatatgaaatgcacacattcagttagtttgtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtaccttcata 25526090  T
Q  119 tacaaatatgttgttagaagcatttagacgcaacactgtatcaagtttggctattttgt 177  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  25526089 tacaaatatgtcgttagaagcatttagacgcaacactgtatcaagtttggctattttgt 25526031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 23 - 137
Target Start/End: Original strand, 25516226 - 25516341
Alignment:
Q  23 ttgcataggaaaggtacacattcagttacttggtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtacct-ttatatac 121  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||| |||| | | ||||    
T  25516226 ttgcatatgaaaggtacacattcagttacttggtttactttcaaatgcatcgaggttcctaagaacacatccagctactgaacatgcacctgtcagatac 25516325  T
Q  122 aaatatgttgttagaa 137  Q
    || ||||| |||||||    
T  25516326 aactatgtagttagaa 25516341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 49 - 140
Target Start/End: Complemental strand, 25540697 - 25540605
Alignment:
Q  49 tacttggtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtaccttt-atatacaaatatgttgttagaagca 140  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||  |||  || |||||||||| |||||||| ||||||||||||||||    
T  25540697 tacttggtttactttcaaatgcatcgagtttcctaagaacacattcatttacctaacatgtacctttcatatacaactatgttgttagaagca 25540605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 196 - 249
Target Start/End: Complemental strand, 31419019 - 31418966
Alignment:
Q  196 ttaaataatggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    |||||||||||||||| |||||||||||||||||||||||| ||||||||||||    
T  31419019 ttaaataatggggtggcggtggctcccccttgccaccccccggttccgccactg 31418966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 21453181 - 21453227
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
T  21453181 atggggtggcggtggctcccccttgccaccccccagttccgccactg 21453227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 12003331 - 12003377
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||    
T  12003331 atggggtggcggtggctcctccttgccaccccccagttccgccactg 12003377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 213 - 249
Target Start/End: Original strand, 6472699 - 6472735
Alignment:
Q  213 ggtggctcccccttgccaccccccagttccgccactg 249  Q
    |||||||||||||||||||||||||||||||||||||    
T  6472699 ggtggctcccccttgccaccccccagttccgccactg 6472735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 25539621 - 25539539
Alignment:
Q  19 atagttgcataggaaaggtacacattcagttacttggtttactttcaaatgcatcgagattcctaagaacacattcagctact 101  Q
    ||||||| ||| || ||||||||| ||  | ||||||| ||||| |||||||| | || ||||||||||||||||||| ||||    
T  25539621 atagttgtatatgacaggtacacaatccttaacttggtctacttccaaatgcaactaggttcctaagaacacattcagttact 25539539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 2e-16; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 1667870 - 1667822
Alignment:
Q  202 aatggggtggtggtggctcccccttgccaccccccagttccgccactgc 250  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||    
T  1667870 aatggggtggcggtggctcccccttgccaccccccagttccgccactgc 1667822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 16658575 - 16658527
Alignment:
Q  202 aatggggtggtggtggctcccccttgccaccccccagttccgccactgc 250  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||    
T  16658575 aatggggtggcggtgtctcccccttgccaccccccagttccgccactgc 16658527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 198 - 250
Target Start/End: Complemental strand, 33360152 - 33360100
Alignment:
Q  198 aaataatggggtggtggtggctcccccttgccaccccccagttccgccactgc 250  Q
    |||||||||||||| ||||||||||||||||||||||| | ||||||||||||    
T  33360152 aaataatggggtggcggtggctcccccttgccaccccctaattccgccactgc 33360100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 198 - 247
Target Start/End: Complemental strand, 42808429 - 42808382
Alignment:
Q  198 aaataatggggtggtggtggctcccccttgccaccccccagttccgccac 247  Q
    |||||||||||||| |||||||||||  ||||||||||||||||||||||    
T  42808429 aaataatggggtggcggtggctcccc--tgccaccccccagttccgccac 42808382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 203 - 235
Target Start/End: Complemental strand, 32381243 - 32381211
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccc 235  Q
    ||||||||| |||||||||||||||||||||||    
T  32381243 atggggtggcggtggctcccccttgccaccccc 32381211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 203 - 235
Target Start/End: Complemental strand, 32435198 - 32435166
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccc 235  Q
    ||||||||| |||||||||||||||||||||||    
T  32435198 atggggtggcggtggctcccccttgccaccccc 32435166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 2e-16; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 2339178 - 2339226
Alignment:
Q  202 aatggggtggtggtggctcccccttgccaccccccagttccgccactgc 250  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||    
T  2339178 aatggggtggcggtggctcccccttgccaccccccagttccgccactgc 2339226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 9456161 - 9456119
Alignment:
Q  206 gggtggtggtggctcccccttgccaccccccagttccgccact 248  Q
    |||||| ||||||||||||||||||||||||||||||||||||    
T  9456161 gggtggcggtggctcccccttgccaccccccagttccgccact 9456119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 203 - 249
Target Start/End: Complemental strand, 52893187 - 52893141
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||| |||||||||||||||||| ||||||||||||||||||    
T  52893187 atggggtggcggtggctcccccttgccaacccccagttccgccactg 52893141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 197 - 245
Target Start/End: Complemental strand, 40922600 - 40922552
Alignment:
Q  197 taaataatggggtggtggtggctcccccttgccaccccccagttccgcc 245  Q
    |||| |||||||||| |||||||||||||||||||||||  ||||||||    
T  40922600 taaaaaatggggtggcggtggctcccccttgccaccccctggttccgcc 40922552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 6e-16; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 21745033 - 21745080
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactgc 250  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
T  21745033 atggggtggcggtggctcccccttgccaccccccagttccgccactgc 21745080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 42740888 - 42740935
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactgc 250  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
T  42740888 atggggtggcggtggctcccccttgccaccccccagttccgccactgc 42740935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 203 - 249
Target Start/End: Complemental strand, 32863379 - 32863333
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
T  32863379 atggggtggcggtggctcccccttgccaccccccagttccgccactg 32863333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 3173895 - 3173848
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactgca 251  Q
    ||||||||| ||||||||||||||||||| |||||||||||||||||||    
T  3173895 atggggtggcggtggctcccccttgccac-ccccagttccgccactgca 3173848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 26063089 - 26063041
Alignment:
Q  201 taatggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||||| |||||||||||||||||||||||| | ||||||||||    
T  26063089 taatggggtggcggtggctcccccttgccaccccccggctccgccactg 26063041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 18740036 - 18740081
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||| ||||||||||||||||||  |||||||||||||||||    
T  18740036 atggggtggcggtggctcccccttgcca-accccagttccgccactg 18740081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 43299980 - 43299937
Alignment:
Q  205 ggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||| ||||||||||||||||||  |||||||||||||||||    
T  43299980 ggggtggcggtggctcccccttgcca-accccagttccgccactg 43299937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 197 - 249
Target Start/End: Complemental strand, 39375 - 39323
Alignment:
Q  197 taaataatggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    |||||||||||||||  |||||||||||||||||||||| |||||||||||||    
T  39375 taaataatggggtggctgtggctcccccttgccaccccctagttccgccactg 39323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 197 - 249
Target Start/End: Original strand, 14800352 - 14800404
Alignment:
Q  197 taaataatggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    |||||||||||||||  |||||||||||||||||||||| |||||||||||||    
T  14800352 taaataatggggtggctgtggctcccccttgccaccccctagttccgccactg 14800404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 252
Target Start/End: Original strand, 33754312 - 33754363
Alignment:
Q  201 taatggggtggtggtggctcccccttgccaccccccagttccgccactgcac 252  Q
    ||||||||||| ||||||||||||||||||||||||||||| ||||| ||||    
T  33754312 taatggggtggcggtggctcccccttgccaccccccagttctgccaccgcac 33754363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 198 - 248
Target Start/End: Complemental strand, 21421970 - 21421920
Alignment:
Q  198 aaataatggggtggtggtggctcccccttgccaccccccagttccgccact 248  Q
    |||||||||||||| |||||||||||||||||||||||  | |||||||||    
T  21421970 aaataatggggtggcggtggctcccccttgccaccccctggctccgccact 21421920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 46164751 - 46164797
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    |||| |||| |||||||||||||||||||| ||||||||||||||||    
T  46164751 atggagtggcggtggctcccccttgccaccacccagttccgccactg 46164797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 44504379 - 44504331
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactgca 251  Q
    ||||||||| |||||||||||||||||| |||| ||||||||| |||||    
T  44504379 atggggtggcggtggctcccccttgccaacccctagttccgcccctgca 44504331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 8433371 - 8433416
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||| |||||||||||||||||| ||||| ||||||||||||    
T  8433371 atggggtggcggtggctcccccttgcca-cccccggttccgccactg 8433416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 201 - 234
Target Start/End: Complemental strand, 20038023 - 20037990
Alignment:
Q  201 taatggggtggtggtggctcccccttgccacccc 234  Q
    |||||||| |||||||||||||||||||||||||    
T  20038023 taatggggaggtggtggctcccccttgccacccc 20037990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 54785574 - 54785622
Alignment:
Q  203 atggggtggtggtggc--tcccccttgccaccccccagttccgccactg 249  Q
    ||||||||| ||||||  |||||||| ||||||||||||||||||||||    
T  54785574 atggggtggcggtggcgctcccccttcccaccccccagttccgccactg 54785622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 38978988 - 38979032
Alignment:
Q  207 ggtggtggtggctcccccttgccaccccccagttccgccactgca 251  Q
    ||||||||||||||||||||||||||||||||||||| |||||||    
T  38978988 ggtggtggtggctcccccttgccaccccccagttccgtcactgca 38979032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 16497560 - 16497606
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||    
T  16497560 atggggtggcggtggctcccccttgccaccccgcagttccgccactg 16497606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 197 - 250
Target Start/End: Complemental strand, 7170768 - 7170715
Alignment:
Q  197 taaataatggggtggtggtggctcccccttgccaccccccagttccgccactgc 250  Q
    ||||||||||||||| |||||||||||||||||||||||  ||||||| |||||    
T  7170768 taaataatggggtggcggtggctcccccttgccaccccctggttccgcaactgc 7170715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 14125098 - 14125143
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||| | |||||||||||||||||| ||||||||||||||||||    
T  14125098 atggggtagcggtggctcccccttgcca-cccccagttccgccactg 14125143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 203 - 247
Target Start/End: Complemental strand, 26014261 - 26014217
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccac 247  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||    
T  26014261 atggggtggcggtggctcccccttgccaccccccaattccgccac 26014217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 18994625 - 18994673
Alignment:
Q  201 taatggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||||| |||||||||||||||||||||||  | ||||||||||    
T  18994625 taatggggtggcggtggctcccccttgccaccccctggctccgccactg 18994673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 249
Target Start/End: Complemental strand, 26354741 - 26354696
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgccactg 249  Q
    ||||||||| |||||||||||||||||| || |||||||||||||||    
T  26354741 atggggtggcggtggctcccccttgcca-cctccagttccgccactg 26354696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1160 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold1160
Description:

Target: scaffold1160; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 203 - 246
Target Start/End: Complemental strand, 2211 - 2168
Alignment:
Q  203 atggggtggtggtggctcccccttgccaccccccagttccgcca 246  Q
    ||||||||| |||||||||||||| |||||||| ||||||||||    
T  2211 atggggtggcggtggctcccccttaccaccccctagttccgcca 2168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University