View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5007_high_4 (Length: 239)
Name: NF5007_high_4
Description: NF5007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5007_high_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 5 - 239
Target Start/End: Complemental strand, 21830292 - 21830052
Alignment:
| Q |
5 |
gttaaagggactcatgtttgttattttggatttgtgtaaataatttagaagaa---aatgtgtagcttttgggtgagaagttgtggtgtttgccttgccc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | || |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830292 |
gttaaagggactcatgtttgttattttgggtttttatatataacttagaagaagaaaatgtgtagcttttgggtgagaagttgtggtgtttgccttgccc |
21830193 |
T |
 |
| Q |
102 |
ttttataatgttt-caggtcttgaggaagtatttattggtccttcaactttgaatttat---atcttgtgaaaagggtaacttgattctgtctgtcttta |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830192 |
ttttataatgttttcaggtcttgaggaagtatttattggtccttcaactt-gaatttattatatcttgtgaaaagggtaacttgattctgtctgtcttta |
21830094 |
T |
 |
| Q |
198 |
gaattattcaacatttacagtgtcacacaatctacattgtct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830093 |
gaattattcaacatttacagtgtcacacaatctacattgtct |
21830052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University