View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5008-Insertion-4 (Length: 90)
Name: NF5008-Insertion-4
Description: NF5008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5008-Insertion-4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 8e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 8e-21
Query Start/End: Original strand, 8 - 90
Target Start/End: Original strand, 46440914 - 46440995
Alignment:
| Q |
8 |
aacatgactgtgaccatagaacaattcaacttattttacaatgttgacaggcaagaactttactcctttggtggtggtgcttg |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||| ||||| |
|
|
| T |
46440914 |
aacatgactgtgaccaaagaacaattcaacttattttacaatgttgacaggcaa-ctcttcactcgtttggtggtggggcttg |
46440995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University