View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5008_low_11 (Length: 307)
Name: NF5008_low_11
Description: NF5008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5008_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 52 - 293
Target Start/End: Complemental strand, 50190903 - 50190662
Alignment:
| Q |
52 |
aaattgtttaatgataagttttaattggttgatgttttatttacttctacagttatataggtaccacatacatgtaatatgtactgaccccttttatgtc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50190903 |
aaattgtttaatgataagttttaattggttgatgttttatttacttctacagttatataggtaccacatacatgtaatatgtactgaccccttttatgtc |
50190804 |
T |
 |
| Q |
152 |
catcttatcnnnnnnngatgtgtatgcagttgattgtcaaagaggagtgcgaggagccatctcatatagattcactaagctagggactttatattattag |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50190803 |
catcttatctttttttgatgtgtatgcagttgattgtcaaagaggagtgcgaggagccatctcatatagattcactaagctagggactttatattattag |
50190704 |
T |
 |
| Q |
252 |
cttatgcttatataaaagttggactgtagtattgattattat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50190703 |
cttatgcttatataaaagttggactgtagtattgattattat |
50190662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 50190980 - 50191038
Alignment:
| Q |
1 |
acactacttacagcacctatgaagtcaaaccaagaaatacaact-aaaacaaaaattgt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50190980 |
acactacttacagcacctatgaagtcaaaccaagaaatacaactaaaaacaaaaattgt |
50191038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University