View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5008_low_15 (Length: 236)
Name: NF5008_low_15
Description: NF5008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5008_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 70 - 220
Target Start/End: Original strand, 5310522 - 5310673
Alignment:
| Q |
70 |
cttcgtcaaatacaattttcattatctataaaaattccactactcacaagcaatttttattttattt-agaggtgctcacatgcatttttcttctgccaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5310522 |
cttcgtcaaatacaattttcattatctacaaaaattccactactcacaagcaatttctattttattttagaggtgctcacatgcatttttcttctgccaa |
5310621 |
T |
|
| Q |
169 |
atttcaacccatttccatatcaccaccaccgcatttgagttttgtttatttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5310622 |
atttcaacccatttccatatcaccaccaccgcatttgagttttgtttatttt |
5310673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University