View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5008_low_20 (Length: 204)
Name: NF5008_low_20
Description: NF5008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5008_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 47 - 190
Target Start/End: Complemental strand, 32707917 - 32707774
Alignment:
| Q |
47 |
gacttaacattgtttattttgttgtgtacctatgcaaatagtaaatgagtaacaaaaaggcaatattgtaaaactaactagggtgttcaattgctcatgg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32707917 |
gacttaacattgtttattttgttgtgtacctatgtaaatagtaaatgagtaacaaaaaggcaatattgtaaaactaactagggtgttcaattgctcatgg |
32707818 |
T |
 |
| Q |
147 |
attgggttgagcttgttaaaccaacatgataagcacaaaaactt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32707817 |
attgggttgagcttgttaaaccaacatgatacgcacaaaaactt |
32707774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 32708161 - 32708126
Alignment:
| Q |
16 |
aatattagttctgagctatgaagaataaaatgactt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32708161 |
aatattagttctgagctatgaagaataaaatgactt |
32708126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University