View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5009_high_12 (Length: 279)
Name: NF5009_high_12
Description: NF5009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5009_high_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 24 - 279
Target Start/End: Original strand, 31828144 - 31828399
Alignment:
| Q |
24 |
ttatggagcatttggaaggcgagaaacgctnnnnnnnntcaggacaaaaaggtctcaactgataagattgtagatcaagtcggattactctcttggaact |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31828144 |
ttatggagcatttggaaggcgagaaacgctaaaaaaattcaggacaaaaaggtctcgactgataagattgtagatcaagtcagattactctcttggaact |
31828243 |
T |
|
| Q |
124 |
ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttgcacgcttaggtgtcatgggagaagcaaaatcaggaacttg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828244 |
ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttgcactcttaggtgtcatgggagaagcaaaatcaggaactta |
31828343 |
T |
|
| Q |
224 |
aggaaggaatgagaggtacagcttgtgggttttgcagcataggggtgtctctgagg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828344 |
aggaaggaatgagaggtacagcttgtgggttttgcagcataggggtgtctctgagg |
31828399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University