View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5009_high_15 (Length: 241)
Name: NF5009_high_15
Description: NF5009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5009_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 31 - 239
Target Start/End: Complemental strand, 2567874 - 2567667
Alignment:
| Q |
31 |
ataaataaatgcaatattacacatgcttattcatatctatatatccacaatgtaaccnnnnnnn-tctatatatccacaaacaatccatatatccacagt |
129 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2567874 |
ataaataaatgcaatattaca--tgcttattcatatctatatatccacaatgtaaccaaaaaaaatctatatatccacaaacaatccatatatccacagt |
2567777 |
T |
|
| Q |
130 |
gttacaattacaaccactagaacacaaagggaaagtgtagatcaagccaaaccaacgtcaacggattggtggaattacaactacacgtgttagggcaatg |
229 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2567776 |
gttacaattacaaccactagaacactaagggaaagtgtagatcaagccaaaccaacgtcaacggattggtggaattacaactacacgtgttcgggcaatg |
2567677 |
T |
|
| Q |
230 |
gtttttctta |
239 |
Q |
| |
|
|||||||||| |
|
|
| T |
2567676 |
gtttttctta |
2567667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University