View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5009_high_16 (Length: 241)

Name: NF5009_high_16
Description: NF5009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5009_high_16
NF5009_high_16
[»] chr4 (1 HSPs)
chr4 (19-241)||(53958381-53958603)


Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 53958381 - 53958603
Alignment:
19 gattcaccgtaggaagagccatggggctactaggctcgaattgtttcatagggttatcaagtagaacaagtgatccatgttgtggctcaggcttcagagc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53958381 gattcaccgtaggaagagccatggggctactaggctcgaattgtttcatagggttatcaagtagaacaagtgatccatgttgtggctcaggcttcagagc 53958480  T
119 ctgtacagcaaagttacaccaagcaagtgaaaggaaatccattgactcagggtgtgcatctgaaggggatagattaaattctgaagccatgttaatgtga 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53958481 ctgtacagcaaagttacaccaagcaagtgaaaggaaatccattgagtcagggtgtgcatctgaaggggatagattaaattctgaagccatgttaatgtga 53958580  T
219 tgatatcccaaaaacacaagatt 241  Q
    |||||||||||||||||||||||    
53958581 tgatatcccaaaaacacaagatt 53958603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University