View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5009_high_2 (Length: 580)
Name: NF5009_high_2
Description: NF5009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5009_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 186 - 440
Target Start/End: Original strand, 25814482 - 25814736
Alignment:
| Q |
186 |
aagttttgtctacaaatacatgtacccaacaaaatttcagggtgcgtaagaatttatttgtttctaaaccttgtgtcgcctacctttttacttgttgaaa |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814482 |
aagttttgtctacaaatacatgtacccaacaaaatttcagggtgcgtaagaatttatttgtttctaaaccttgtgtcgcctacctttttacttgttgaaa |
25814581 |
T |
|
| Q |
286 |
ttctttctcaagaaagccaatgaatctcacttgcactagcccttcttctacccgaccggaagaatttatcattaaaagtaagggtcatgctaacttaatg |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814582 |
ttctttctcaagaaagccaatgaatctcacttgcactagcccttcttctacccgaccggaagaatttatcattaaaagtaagggtcatgctaacttaatg |
25814681 |
T |
|
| Q |
386 |
tccctgaggcacccatcaaagaaacaaaaagaaaaagttttcattgaaaataata |
440 |
Q |
| |
|
||||| | ||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814682 |
tccctcaagcatccgtcaaagaaacaaaaagaaaaagttttcattgaaaataata |
25814736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 502 - 563
Target Start/End: Original strand, 25814798 - 25814859
Alignment:
| Q |
502 |
gaaaagagtatctcaatgaatcttaatgagcaacctttaagggtggataatccactaatact |
563 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814798 |
gaaaagagtatctcaatgaatcttaatgagcaacctttaagggtggataatccactaatact |
25814859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 10 - 43
Target Start/End: Original strand, 25814429 - 25814462
Alignment:
| Q |
10 |
aagaatatcaccattcaaaaaatatttgctttta |
43 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
25814429 |
aagaaaatcaccattcaaaaaatatttgctttta |
25814462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University