View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5009_low_12 (Length: 279)

Name: NF5009_low_12
Description: NF5009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5009_low_12
NF5009_low_12
[»] chr4 (1 HSPs)
chr4 (24-279)||(31828144-31828399)


Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 24 - 279
Target Start/End: Original strand, 31828144 - 31828399
Alignment:
24 ttatggagcatttggaaggcgagaaacgctnnnnnnnntcaggacaaaaaggtctcaactgataagattgtagatcaagtcggattactctcttggaact 123  Q
    ||||||||||||||||||||||||||||||        |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||    
31828144 ttatggagcatttggaaggcgagaaacgctaaaaaaattcaggacaaaaaggtctcgactgataagattgtagatcaagtcagattactctcttggaact 31828243  T
124 ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttgcacgcttaggtgtcatgggagaagcaaaatcaggaacttg 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||     
31828244 ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttgcactcttaggtgtcatgggagaagcaaaatcaggaactta 31828343  T
224 aggaaggaatgagaggtacagcttgtgggttttgcagcataggggtgtctctgagg 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31828344 aggaaggaatgagaggtacagcttgtgggttttgcagcataggggtgtctctgagg 31828399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University