View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5009_low_14 (Length: 246)
Name: NF5009_low_14
Description: NF5009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5009_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 50307912 - 50308023
Alignment:
| Q |
1 |
ataatcaagaccaaaatgaaaatacggatacaaaccaagaagaaggcaacattaatgagagtgataaaaaagaaatgaatgattcaacaaatgaaggaga |
100 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50307912 |
ataatcaagatcaaaatgagaatacggatacaaaccaagaagaagggaacattaatgagagtgataaaaaagaaatgaatgattcaacaaatgaaggaga |
50308011 |
T |
 |
| Q |
101 |
agttatcgaggc |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
50308012 |
agttatcgaggc |
50308023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University