View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5009_low_7 (Length: 366)
Name: NF5009_low_7
Description: NF5009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5009_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 293
Target Start/End: Complemental strand, 2698821 - 2698540
Alignment:
| Q |
17 |
agaaatatgataagtaaattattcagatttatcaaaatggatgattagtaacataaatgaattgaat-attatattcattaat----aacaccattacta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
2698821 |
agaaatatgataagtaaattattcagatttgtcaaaatggatatttggtaacataaatgaattgaatcattatatccattaattaataacaccattacta |
2698722 |
T |
|
| Q |
112 |
atatcggcacttaattctcaaaacctctgttcaaattgtctaggtttgtgacgtgatgctatttcttttaaaatggttgatcaatatcgtcaccatcgtt |
211 |
Q |
| |
|
|||||| |||| |||||||||||| || ||||||||||||||||||||||||||||| ||||||| |||||||| ||||||| ||||||||||| || || |
|
|
| T |
2698721 |
atatcgacactaaattctcaaaacttccgttcaaattgtctaggtttgtgacgtgatactatttcgtttaaaatagttgatcgatatcgtcaccgtcatt |
2698622 |
T |
|
| Q |
212 |
gatgtacagttgatatagatatgaatcatttgacagtttgaggttgtgctttggattgtaatgcttgaaagggcggtgtctt |
293 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
2698621 |
gatgtatagttgatataggtatgaatcatttgacagtttgaggttttgctttggactgtaatgcttgaaaggacggtgtctt |
2698540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 291 - 349
Target Start/End: Complemental strand, 2698499 - 2698441
Alignment:
| Q |
291 |
cttatgtgtgagtgtttttgtcatagtaaatggtgggtacgtgtgcaattgcttctgtg |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2698499 |
cttatgtgtgggtgttttcgtcatagtaaatggtgggtacgtgtgcaactgcttctgtg |
2698441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University