View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5010-Insertion-4 (Length: 195)
Name: NF5010-Insertion-4
Description: NF5010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5010-Insertion-4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 8 - 195
Target Start/End: Complemental strand, 24718304 - 24718116
Alignment:
| Q |
8 |
ccttttttctcacacaataagccacttttgtttatataagctttagaacaaaaagaaacgtgattgttaaatttctgaggtgaattagtttttattgtca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24718304 |
ccttttttctcacacaataagccacttttgtttatacaagctttagaacaaaaagaaacatgattgttaaatttctgaagtgaattagtttttattgtca |
24718205 |
T |
|
| Q |
108 |
actttaaatcataccggttccatgnnnnnnntgatct-cgcttcttctttaggcaggttttctacagtgtctctcaacattagctatac |
195 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24718204 |
actttaaatcataccggttccatgaaaaaaatgatctccgcttcttctttaggcaggttttctacagtgtctctcaacattagctatac |
24718116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University