View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5010_high_2 (Length: 330)
Name: NF5010_high_2
Description: NF5010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5010_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 17 - 322
Target Start/End: Original strand, 49976630 - 49976935
Alignment:
| Q |
17 |
tttatgactttgttaattattacaggagaccagatggaaatccattagaccttaacaatctgcctgatgacaactctagtagagatcaccatgctaaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976630 |
tttatgactttgttaattattacaggagaccagatggaaatccattagaccttaacaatctgcctgatgacaactctagtagagatcaccatgctaaaca |
49976729 |
T |
 |
| Q |
117 |
acttcttcctgacaccacctccccaccacctggtaattcagtaatttatttaattaattaaatcttcttcttcattagtgatcacataaccaaaacaaca |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49976730 |
acttctttctgacaccacctccccaccacctggtaattcagtaatttatttaattaattaaatcttcttcttcattagtaatcacataaccaaaacaaca |
49976829 |
T |
 |
| Q |
217 |
taannnnnnnnnnaatttattattttcacaatagcgcaccatgaaaataaaatgaaagactaggtcatggnnnnnnncaccatgatacattactcttttt |
316 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49976830 |
taattttttttttaatttattattttcacaatagcgcaccatgaaaataaaatgaaagactaggtcatggtttttttcaccatgatacattactcttttt |
49976929 |
T |
 |
| Q |
317 |
cttctc |
322 |
Q |
| |
|
|||||| |
|
|
| T |
49976930 |
cttctc |
49976935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University