View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5010_high_3 (Length: 319)
Name: NF5010_high_3
Description: NF5010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5010_high_3 |
 |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 1e-78; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 138 - 294
Target Start/End: Original strand, 3011630 - 3011786
Alignment:
| Q |
138 |
gcttcattacgtccggtttaatgccagttttctatgcttcagctgctttgacttagtttaatattaattaatactaattctcgatgccttaattaatttg |
237 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3011630 |
gcttcattacgtcctgtttaatgccagttttctatgcttcagccgctttgacttagtttaatattaattaatactaattctcgatgccttaattaatttg |
3011729 |
T |
 |
| Q |
238 |
tagaaaaagaatccgaatttgaaaaactaaagggttgtaggaatcgaatgagtgaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3011730 |
tagaaaaagaatccgaatttgaaaaactaaagggttgtaggaatcgaatgagtgaat |
3011786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 139 - 203
Target Start/End: Complemental strand, 3794923 - 3794859
Alignment:
| Q |
139 |
cttcattacgtccggtttaatgccagttttctatgcttcagctgctttgacttagtttaatatta |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
3794923 |
cttcattacgtcctgtttaatgccagttttctatgcttccgctgctttgacttggtttaatatta |
3794859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 238 - 285
Target Start/End: Complemental strand, 3794860 - 3794813
Alignment:
| Q |
238 |
tagaaaaagaatccgaatttgaaaaactaaagggttgtaggaatcgaa |
285 |
Q |
| |
|
||||||||||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
3794860 |
tagaaaaagaacctgaatttgaaaaactcaagggttgtaggaatcgaa |
3794813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 32364921 - 32364878
Alignment:
| Q |
22 |
aaacttgctgaaaaccggttaaaaccggtgactcggccggtttt |
65 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32364921 |
aaactcgctaaaaaccggttaaaaccggtgactcggccggtttt |
32364878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 42 - 79
Target Start/End: Original strand, 3011534 - 3011571
Alignment:
| Q |
42 |
aaaaccggtgactcggccggttttatgaaccgatccgg |
79 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3011534 |
aaaaccgatgactcggccggttttatgaaccgatccgg |
3011571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 73
Target Start/End: Complemental strand, 50656288 - 50656247
Alignment:
| Q |
32 |
aaaaccggttaaaaccggtgactcggccggttttatgaaccg |
73 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| |||||||| |
|
|
| T |
50656288 |
aaaaccggtgaaaaccggtgactcggcaggtttgatgaaccg |
50656247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 140 - 216
Target Start/End: Complemental strand, 31814475 - 31814398
Alignment:
| Q |
140 |
ttcattacgtccggttt-aatgccagttttctatgcttcagctgctttgacttagtttaatattaattaatactaatt |
216 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| |||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
31814475 |
ttcattacgtcctgttttaataccagttttctaagcttcaacttctttgacttggtttaatattaattaatactaatt |
31814398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 32 - 73
Target Start/End: Original strand, 23292446 - 23292487
Alignment:
| Q |
32 |
aaaaccggttaaaaccggtgactcggccggttttatgaaccg |
73 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
23292446 |
aaaaccggtgaaaaccggtgactcggccggtttgatgaaccg |
23292487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 65
Target Start/End: Original strand, 39760791 - 39760824
Alignment:
| Q |
32 |
aaaaccggttaaaaccggtgactcggccggtttt |
65 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
39760791 |
aaaaccagttaaaaccggtgactcggccggtttt |
39760824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 218
Target Start/End: Original strand, 32382621 - 32382676
Alignment:
| Q |
165 |
ttttctatgcttcagctgctttgactta--gtttaatattaattaatactaattct |
218 |
Q |
| |
|
|||||||||||| |||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32382621 |
ttttctatgctttagctactttgacttttggtttaatattaattaatactaattct |
32382676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 65
Target Start/End: Complemental strand, 6460492 - 6460459
Alignment:
| Q |
32 |
aaaaccggttaaaaccggtgactcggccggtttt |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
6460492 |
aaaaccggttaaaaccggtgactcggacggtttt |
6460459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 65
Target Start/End: Complemental strand, 8597 - 8564
Alignment:
| Q |
32 |
aaaaccggttaaaaccggtgactcggccggtttt |
65 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
8597 |
aaaaccggttaaaaccggtgactcggccgatttt |
8564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University