View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5010_low_5 (Length: 279)
Name: NF5010_low_5
Description: NF5010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5010_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 4830858 - 4831121
Alignment:
| Q |
1 |
aacttggatgtggaaccctaaacaacaccaagaacaagaagatgaagattcatgggaggtaagggcttttgctgaagacacaaggaatattatgaacaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4830858 |
aacttggatgtggaaccctaaacaacaccaagaacaagaagatgaagattcatgggaggtaagggcttttgctgaagacacaaggaatattatgaacaca |
4830957 |
T |
|
| Q |
101 |
acatggccaccaaggtcctacacctgcaccttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttcaccgccgcgaccgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4830958 |
acatggccaccaaggtcctacacctgtaccttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttcaccgccgcgaccgtg |
4831057 |
T |
|
| Q |
201 |
ctcgtctccatcaaacccaaccaccgttaaattcatctcatccttcatcaccattcataaatat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4831058 |
ctcgtctccatcaaacccaaccaccgttaaattcttctcatccttcatcaccattcataaatat |
4831121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 130 - 186
Target Start/End: Original strand, 34522611 - 34522667
Alignment:
| Q |
130 |
cttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttca |
186 |
Q |
| |
|
|||||| | ||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
34522611 |
cttttgtaaaagagagtttaggtctgctcaagctcttggtggtcacatgaatattca |
34522667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 102 - 186
Target Start/End: Complemental strand, 31844623 - 31844539
Alignment:
| Q |
102 |
catggccaccaaggtcctacacctgcaccttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttca |
186 |
Q |
| |
|
||||||||||||| || ||||| || | |||||| |||| |||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31844623 |
catggccaccaagatcatacacatgtagcttttgtagaaaagagtttaaatcagctcaagcacttggaggtcacatgaatgttca |
31844539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University