View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5010_low_6 (Length: 248)
Name: NF5010_low_6
Description: NF5010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5010_low_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 248
Target Start/End: Original strand, 36283207 - 36283446
Alignment:
| Q |
9 |
attattctaacctaaggctaataaagaatcaaatgatttagacttcttccgtcgattccacatggagattgtttgatataatggattttatgaacaaaac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36283207 |
attattctaacctaaggctaataaagaatcaaatgatttagacttcttccgtcgattccacatggagaatgtttgatataatggattttatgaacaaaac |
36283306 |
T |
|
| Q |
109 |
aaactgcgtttttcttgctgtctttttccacacttaatgaagtggtatatgtgatgatataatatgcacataagtcatacatatttgattgattatattt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36283307 |
aaactgcgtttttcttgctgtcattttccacacttaatgaagtggtatatgtgatgatataatatgcacataagtcatacatatttgattgattatattt |
36283406 |
T |
|
| Q |
209 |
tacattggttcctactaattcttctttgttccattcaagt |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36283407 |
gacattggttccttctaattcttctttgttccattcaagt |
36283446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University