View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5011_low_14 (Length: 308)
Name: NF5011_low_14
Description: NF5011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5011_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 303
Target Start/End: Original strand, 30618090 - 30618374
Alignment:
| Q |
19 |
gaaagtgcatgccaattagatgcattcgttgctgcataaatggcttgttctgttaaatgggaagtgttgttgatgatgctatgatcttgttcagttctat |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30618090 |
gaaagtgcatgccaattagatgcatttgttgctgcatagatggcttgttctgttaaatgggaagtgttgttgatgatgctatgatcttgttcagttctat |
30618189 |
T |
 |
| Q |
119 |
ggctaatatcaacattcacatgattcaattcaacttgctccatgtcttttaaacgctttgcagcaccaccaattggtaatgtgctgctctcaagtatggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30618190 |
ggctaatatcaacattcacatgattcaattcaacttgctccatgtcttttaaacgctttgcagcaccaccaattggtaatgtgctgctctcaagtatggt |
30618289 |
T |
 |
| Q |
219 |
tttgacatcatatctgctcatgtcaaagtttgtaactgcactcagtcctctgaattttattgctgccacatcatatgcctatgct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30618290 |
tttgacatcatatctgctcatgtcaaagtttgtaactgcactcagtcctctgaattttattgctgccacatcatatgcctctgct |
30618374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 75 - 188
Target Start/End: Original strand, 54689360 - 54689473
Alignment:
| Q |
75 |
atgggaagtgttgttgatgatgctatgatcttgttcagttctatggctaatatcaacattcacatgattcaattcaacttgctccatgtcttttaaacgc |
174 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||| |||||| |||||||||||||||| ||||| |||||| |||||| ||||||||||| || |
|
|
| T |
54689360 |
atgggaagtcttgttgatgatgatatgatcttgttacgttatatggccaatatcaacattcacacgattcgattcaatttgctctatgtcttttaactgc |
54689459 |
T |
 |
| Q |
175 |
tttgcagcaccacc |
188 |
Q |
| |
|
||| || ||||||| |
|
|
| T |
54689460 |
tttacaacaccacc |
54689473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 284
Target Start/End: Original strand, 24561661 - 24561709
Alignment:
| Q |
236 |
tcatgtcaaagtttgtaactgcactcagtcctctgaattttattgctgc |
284 |
Q |
| |
|
|||||||||||||||| || || | ||||||||||||||||||||||| |
|
|
| T |
24561661 |
tcatgtcaaagtttgttacagcgttgagtcctctgaattttattgctgc |
24561709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University