View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5011_low_24 (Length: 253)

Name: NF5011_low_24
Description: NF5011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5011_low_24
NF5011_low_24
[»] chr4 (2 HSPs)
chr4 (85-159)||(32827310-32827385)
chr4 (208-253)||(32827061-32827106)


Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 85 - 159
Target Start/End: Complemental strand, 32827385 - 32827310
Alignment:
85 ttagttcccagactcaccc-atctgcatgggtcaagtttatttatttgatcatgcatcttctgaatataatgacag 159  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
32827385 ttagttcccagactcaccccatctgcatgggtcaagtttatttatttgataatgcatcttctgaatataatgacag 32827310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 208 - 253
Target Start/End: Complemental strand, 32827106 - 32827061
Alignment:
208 gagaccatcatgattaaggtactagcaaaggcaacacttcaaagtt 253  Q
    |||| ||||||||||||||||| |||||||||||||||||||||||    
32827106 gagatcatcatgattaaggtaccagcaaaggcaacacttcaaagtt 32827061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University