View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5012_low_3 (Length: 359)
Name: NF5012_low_3
Description: NF5012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5012_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 9 - 245
Target Start/End: Complemental strand, 27219726 - 27219490
Alignment:
| Q |
9 |
gagaagaattgtatgtcttgaggtatttggtattccaccttttgcatggtgcagaccgaattttgaatttacagtagctcagattggtagacttgcttgg |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
27219726 |
gagaagaagtgtatgtcttgaggtatttggtattccaccttttgcatggtgcagaccgaattttgaatttgcagtagctcaaatcggtagacttgcttgg |
27219627 |
T |
|
| Q |
109 |
ctagatccagaggttgaagaaggggttgagctggagttggcgaagttttagtctacactgacttgatgctttttatcgacgaccatttcttactccaaaa |
208 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27219626 |
ctagatccagaagttgaagaaggggttgagctggagttggcaaagttttagtctacactgacttgatgctttttattaacgaccatttcttactccaaat |
27219527 |
T |
|
| Q |
209 |
aaggttatttgcaagaaattaaacgatttgtagattt |
245 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27219526 |
aaggttatttgcaagaaattaagggatttgtagattt |
27219490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 313 - 356
Target Start/End: Complemental strand, 27219422 - 27219379
Alignment:
| Q |
313 |
gtacataggaaataaatgctcccttattcttaagcttcttgatc |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27219422 |
gtacataggaaataaatgctcccttattcttaagcttcttgatc |
27219379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University