View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5012_low_5 (Length: 239)
Name: NF5012_low_5
Description: NF5012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5012_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 5 - 220
Target Start/End: Original strand, 32000680 - 32000895
Alignment:
| Q |
5 |
atcaaaaaatgcatataaattaattaatatggcgtcttgattttgtaatttctgtttattgttcgtcttgtgcagagacttgattattagtaaatttctc |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||| ||| || |||||||| |||||||||||| |||||||||||||||||| |||||||||||| || |
|
|
| T |
32000680 |
atcaaaaaatgcatataagttaattaattcggcgccttagttatgtaatttatgtttattgttcagcttgtgcagagacttgatcattagtaaatttttc |
32000779 |
T |
 |
| Q |
105 |
cgtt-nnnnnnntcgatgtataannnnnnnactcaatgttactataattatttacaactgtnnnnnnncatatatttattgcaaatgggtaacaacaaat |
203 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32000780 |
agttaaaaaaaatcgatgtataatttttttactcaatgttactataattatttacaactgt-aaaaaacatatatttattgcaaatgggtaacaacaaat |
32000878 |
T |
 |
| Q |
204 |
tgaaacttgtagcaggt |
220 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32000879 |
tgaaacttgtagcaggt |
32000895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 101
Target Start/End: Complemental strand, 3734694 - 3734660
Alignment:
| Q |
67 |
tcgtcttgtgcagagacttgattattagtaaattt |
101 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3734694 |
tcgtcttgtgcagagacttgattattaataaattt |
3734660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University