View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5012_low_6 (Length: 236)
Name: NF5012_low_6
Description: NF5012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5012_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 5463688 - 5463893
Alignment:
| Q |
16 |
aaaacaacagttggaggctgcggctactcatatgggaccatcaagtcggaagaaga------ccaccaagaggaagatgaagaaaaacaagagaagcaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5463688 |
aaaacaacagttggaggctgcggctactcatatgggaccatcaagtcggaagaagaatgagaccaccaagaggaagatgaagaaaaacaagagaagcaag |
5463787 |
T |
 |
| Q |
110 |
ttgaagataccatttaacttttaattataggttggaatcatgtgtgttagttagttagtggcttcttatgttatatattatgtttttggttacagattta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5463788 |
atgaagataccatttaacttttaattataggttggaatcatgtgtgttagttagttagtggcttcttatgttatatattatgtttttggttacagaatta |
5463887 |
T |
 |
| Q |
210 |
cattct |
215 |
Q |
| |
|
|||||| |
|
|
| T |
5463888 |
cattct |
5463893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 165
Target Start/End: Complemental strand, 4524698 - 4524659
Alignment:
| Q |
126 |
acttttaattataggttggaatcatgtgtgttagttagtt |
165 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
4524698 |
actttcaattataggttggaatcatgtgtgttagtgagtt |
4524659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University