View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5012_low_8 (Length: 215)
Name: NF5012_low_8
Description: NF5012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5012_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 12228234 - 12228036
Alignment:
| Q |
1 |
atgcatgcatggtggcaaaatgacatacctgatatgttttcttcacattgtgcctttcgtttccttccttttctttggaaatgtgaagcactaatactaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12228234 |
atgcatgcatggtggtaaaatgacatacctgatatgttttcttcacattgtgcctttcgtttccttccttttctttggaaatgtgaagcactaatactaa |
12228135 |
T |
|
| Q |
101 |
cttctatacgatgcaattactattttattcagttgttttgaatattaagttcaaacgggtttttgattatactattgcattggaccaacgtcaaatttg |
199 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
12228134 |
cttcaatacaatgcaattactattttattcagttgttttgaatattatgttcaaacgggtttttaattatactattgcattggaccggcgtcaaatttg |
12228036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 35167652 - 35167742
Alignment:
| Q |
1 |
atgcatgcatggtggcaaaatgacatacctgatatgttttcttcacattgtgcctttcgtttccttccttttctttggaaatgtgaagcact |
92 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| || |||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35167652 |
atgcatgcatggtggcaaaatgaactacctgatatgttt-ctccacattgtgcatttcgtttccttccttttcgttggaaatgtgaagcact |
35167742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 45099852 - 45099660
Alignment:
| Q |
1 |
atgcatgcatggtggcaaaatgacatacctgatatgttttcttcacattgtgcctttcgtttccttccttttctttggaaatgtgaagcactaatactaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45099852 |
atgcatgcatggtggcaaaatgacatacctcatatgttttcttcacattgtgcctttcgtttccttccttttctttggaaaa------cactaatactaa |
45099759 |
T |
|
| Q |
101 |
cttctatacgatgcaattactattttattcagttgttttgaatattaagttcaaacgggtttttgattatactattgcattggaccaacgtcaaatttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45099758 |
cttctatacgatgcaattactattttattcagttgttttgaatattaagttcaaacgggtttttgattatactattgcattggaccaacgtcaaatttg |
45099660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University