View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5013-Insertion-3 (Length: 187)
Name: NF5013-Insertion-3
Description: NF5013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5013-Insertion-3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 11 - 187
Target Start/End: Complemental strand, 26351343 - 26351167
Alignment:
| Q |
11 |
tagactcttcatgtttgctttggaatatgcggttcaacatcattggcatcatctataggtggaaggtgatccttaaagtgctttgcaggtttttagggac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26351343 |
tagactcttcatgtttgctttggaatatgcggttcaacatcattggcatcatctataggtggaaggtgatccttagagtgctttgcaggtttttagggac |
26351244 |
T |
|
| Q |
111 |
tcatccttagttccatacactattcgcaaccgttggcataactggattcaaggtgtaatttcaattctttcatctca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||| |
|
|
| T |
26351243 |
tcatccttagttccatacactattcgcaaccgttggcataattgtactcaaggtgtaatttcaattctttcatctca |
26351167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University