View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5013_low_2 (Length: 261)
Name: NF5013_low_2
Description: NF5013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5013_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 243
Target Start/End: Complemental strand, 37166227 - 37165996
Alignment:
| Q |
12 |
atcatcaccggtaatcgtagcgtggttgatggttggaccactttccaatccgcaacttttggtaagctaattaatagttcgaacacacgacacactctaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37166227 |
atcatcaccggtaatcgtagcgtggttgatggttggaccactttccaatccgcaacttttggtaagctaattaatagttcgaacacacgacacactctaa |
37166128 |
T |
 |
| Q |
112 |
taacgtttaaattttactctcataacgcgtataatttatatgcgttatgatagatataatcattataactcaagtatcatggtcatctgatacacacact |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
37166127 |
taacgtttaaattttactctcataacgcgtataatttatatgcgttatgatagatataatcattataactcaagtatcaaggtcatctgataaacacact |
37166028 |
T |
 |
| Q |
212 |
cacgaaacttttggtcacgcaccaggtcatct |
243 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |
|
|
| T |
37166027 |
cacgaaacttttggtcacgcgccaggtcatct |
37165996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University