View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5014-Insertion-11 (Length: 105)
Name: NF5014-Insertion-11
Description: NF5014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5014-Insertion-11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 9e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 9e-21
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 45904928 - 45904866
Alignment:
| Q |
8 |
ggtagtattttaaagtgtataggggaaactttttatttttgagtaaatgtataggggaaagat |
70 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45904928 |
ggtagtattataaagtgtataggggaaagattttatttttgagtaaatgtataggggaaagat |
45904866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 55 - 105
Target Start/End: Complemental strand, 45904913 - 45904860
Alignment:
| Q |
55 |
tgtataggggaaagattttatttttgagt-aatgtat--gggaaagatattgag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
45904913 |
tgtataggggaaagattttatttttgagtaaatgtataggggaaagatattgag |
45904860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University