View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5015-Insertion-13 (Length: 116)
Name: NF5015-Insertion-13
Description: NF5015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5015-Insertion-13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 37032654 - 37032546
Alignment:
| Q |
8 |
ataactacgtatacgtgaatttattaataaagacaattcaactttacgtaggtttagacttattatttgcatgtatgctctctcatatcgaagacgttga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37032654 |
ataactacgtatacgtgaatttattaataaagacaattcaactttacgtaggtttagacttattatttgcatgtatgctctctcatatcgaagacgttga |
37032555 |
T |
|
| Q |
108 |
ctacttcta |
116 |
Q |
| |
|
||||||||| |
|
|
| T |
37032554 |
ctacttcta |
37032546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University