View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5015_high_11 (Length: 416)
Name: NF5015_high_11
Description: NF5015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5015_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 2e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 17 - 127
Target Start/End: Original strand, 9394064 - 9394174
Alignment:
| Q |
17 |
attagcttgcactgtggctttcttcaactggtggaagattcattgcaagatgaagattgttaaatatcgaccaaattcatatgggaaatgaaatctggaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9394064 |
attagcttgcactgtggctttcttcaactggtggaagattcattgcaagatgaagattgttaaatatcgaccaaattcatatgggaaatgaaatcgggaa |
9394163 |
T |
|
| Q |
117 |
aagggcttaaa |
127 |
Q |
| |
|
||||||||||| |
|
|
| T |
9394164 |
aagggcttaaa |
9394174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 291 - 407
Target Start/End: Original strand, 9394728 - 9394842
Alignment:
| Q |
291 |
agcatgatggtcgacgaatcacagggtgtgtattgataggtttgtagctcaaatgttcactatcagtcaagaaatatacacattattttctctaacaaag |
390 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394728 |
agcatgatggtcgacgaatcacagggtgt--attgataggtttgtagctcaaatattcactatcagtcaagaaatatacacattattttctctaacaaag |
9394825 |
T |
|
| Q |
391 |
ccaaatgatcttctctg |
407 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
9394826 |
cgaaatgatcttctctg |
9394842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University