View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5015_high_19 (Length: 367)
Name: NF5015_high_19
Description: NF5015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5015_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 2 - 351
Target Start/End: Complemental strand, 6060523 - 6060174
Alignment:
| Q |
2 |
aaagcaatatcttctatatcctgagtcagacttagtacctatttgggattttctatatattaaccacgggagagttcgccaagaggtatagaattatatt |
101 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6060523 |
aaagcaatatcttctatatcctgtgtcagacttggtacctattttggattttctatatattatccacgggagagttcgccaagaggtatagaattacatt |
6060424 |
T |
|
| Q |
102 |
tttgaaaaatctcagaattgtctagtttcttggaagggagcccttcttaataagcgagtagggcttgcagaacatctaagaggctaaaatctaattaaat |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6060423 |
tttgaaaaatctcagagttgtctagtttcttggaagggagcccttcttaataagcgagtagggcttgcagaacatttaagaggctaaaatctaattaaat |
6060324 |
T |
|
| Q |
202 |
tattaaggagttggtggttcttgatcttgcaactcttaatctttttattnnnnnnncttgtggaacttagagtaaatactgaagttcaacttcatcctct |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6060323 |
tattaaggagttggtggttcttgatcttgcaactcttaatctttttattaaaaaaacttgtggaacttagagtaaatactgaagttcaacttcatcctct |
6060224 |
T |
|
| Q |
302 |
gacttcagtcacttgtttcaagttactatttcaaattcgtctctgatatt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6060223 |
gacttcagtcacttgtttcaagttactatttcaaattcgtctctgatatt |
6060174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University