View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5015_high_32 (Length: 252)
Name: NF5015_high_32
Description: NF5015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5015_high_32 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 252
Target Start/End: Complemental strand, 31089093 - 31088850
Alignment:
| Q |
9 |
agcagagaattgcagttaaatgtgtgctcaatcgtgactgcatcatggttttggcaacataaaaactgtcatgttgcagtggcgacttttatttaaaacc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31089093 |
agcagagaattgcagttaaatgtgtgctcaatcgtgactgcatcgtggttttggcaacataaaaactgtcatgttgcagtggcgacttttatttaaaacc |
31088994 |
T |
|
| Q |
109 |
ttgaacatatcttccgtaaactcccccatagaagcaactgatagagtttatgataaggagttacccttcgttctttcctcgattagaaaaacatgtaata |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31088993 |
ttgaacatatcttccgtaaactcccctatagaagcaactgatagagtttatgataaggagttacccttcgttctttcctcgattagaaaaacatgtaata |
31088894 |
T |
|
| Q |
209 |
aacatttatcctgcataaacgctcattgaaactgttaaaatcca |
252 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31088893 |
aacatttatcctgcataaacactcattgaaactgttaaaatcca |
31088850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University