View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5015_high_39 (Length: 244)

Name: NF5015_high_39
Description: NF5015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5015_high_39
NF5015_high_39
[»] chr4 (1 HSPs)
chr4 (53-227)||(3047906-3048080)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 53 - 227
Target Start/End: Original strand, 3047906 - 3048080
Alignment:
53 gttttgacaaagcataattgcttgagttgagtatgtccttcttgtgttaggattcttaataatctaatttggacgcattcacgaagtaaatgaatccaat 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3047906 gttttgacaaagcataattgcttgagttgagtatgtccttcttgtgttaggattcttaataatctaatttggacgcattcacgaagtaaatgaatccaat 3048005  T
153 ggttcagattgattcaaaccataaaattgtgttgctattactggtcactgtatgtctataaaacatcaatgaact 227  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3048006 ggttcagattgattcaaaccataaaattgtgttgctattactggtcactgtatgtctataaaacatcaatgaact 3048080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University