View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5015_low_37 (Length: 246)
Name: NF5015_low_37
Description: NF5015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5015_low_37 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 127 - 246
Target Start/End: Original strand, 9123235 - 9123346
Alignment:
| Q |
127 |
ataagacaaatttgaactcaatctatttatcattcaattcatatgttcttttctcaaactatcctacgactcccactcaattgcatatgacaggaatggc |
226 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9123235 |
ataagacaaatttgaacttaatctatttatcattcaattcatatgttcttctctcaa--------acgactcccattcaattgcatatgacaggaatggt |
9123326 |
T |
|
| Q |
227 |
gtccttttaaattatttttt |
246 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
9123327 |
ttacttttaaattatttttt |
9123346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 27 - 69
Target Start/End: Original strand, 9122680 - 9122722
Alignment:
| Q |
27 |
tagtctaggtgaaaaaattgatagtgcagttgattatattata |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9122680 |
tagtctaggtgaaaaaattgatagtgcagttgattatattata |
9122722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University