View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5015_low_45 (Length: 217)
Name: NF5015_low_45
Description: NF5015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5015_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 4 - 199
Target Start/End: Complemental strand, 25508102 - 25507907
Alignment:
| Q |
4 |
taaaagtagtttatgcatcgattcaaggagaatttgtagtcgatgattcaagggatcttgcagcagtttggaatggtttaattcctttaaaagtttcagt |
103 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25508102 |
taaaagtagtttatgcatcgattctaggagaatttgtagtcgatgattcaagggatcttgcagcagtttggaatggtttaattcctttaaaagttccagt |
25508003 |
T |
 |
| Q |
104 |
tttcatgtggagaatattatgaaataggatatcgtcgagggacaaaaatggatcagtggaaacatggctaaaataaagatataaaattgctatcat |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25508002 |
tttcatgtggagaatattttgaaataggatattgtcgagggacaaaaatggatcagtggaaacatggctaaaataaagatataaaattgctatcat |
25507907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 115
Target Start/End: Complemental strand, 13335710 - 13335643
Alignment:
| Q |
48 |
gattcaagggatcttgcagcagtttggaatggtttaattcctttaaaagtttcagttttcatgtggag |
115 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
13335710 |
gattcaagggatcttgctgcggtgaggaatggtttaattccattgaaagtttcagtttttgtgtggag |
13335643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University