View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5015_low_45 (Length: 217)

Name: NF5015_low_45
Description: NF5015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5015_low_45
NF5015_low_45
[»] chr1 (1 HSPs)
chr1 (4-199)||(25507907-25508102)
[»] chr7 (1 HSPs)
chr7 (48-115)||(13335643-13335710)


Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 4 - 199
Target Start/End: Complemental strand, 25508102 - 25507907
Alignment:
4 taaaagtagtttatgcatcgattcaaggagaatttgtagtcgatgattcaagggatcttgcagcagtttggaatggtttaattcctttaaaagtttcagt 103  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
25508102 taaaagtagtttatgcatcgattctaggagaatttgtagtcgatgattcaagggatcttgcagcagtttggaatggtttaattcctttaaaagttccagt 25508003  T
104 tttcatgtggagaatattatgaaataggatatcgtcgagggacaaaaatggatcagtggaaacatggctaaaataaagatataaaattgctatcat 199  Q
    |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25508002 tttcatgtggagaatattttgaaataggatattgtcgagggacaaaaatggatcagtggaaacatggctaaaataaagatataaaattgctatcat 25507907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 115
Target Start/End: Complemental strand, 13335710 - 13335643
Alignment:
48 gattcaagggatcttgcagcagtttggaatggtttaattcctttaaaagtttcagttttcatgtggag 115  Q
    ||||||||||||||||| || ||  |||||||||||||||| || ||||||||||||||  |||||||    
13335710 gattcaagggatcttgctgcggtgaggaatggtttaattccattgaaagtttcagtttttgtgtggag 13335643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University