View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5016_high_5 (Length: 207)
Name: NF5016_high_5
Description: NF5016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5016_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 5 - 190
Target Start/End: Complemental strand, 33483907 - 33483721
Alignment:
| Q |
5 |
atccaaatccttacaatccacaactttatggaatacnnnnnnnnn-taagacggcaaatgttatcatcctaaaacagactaggatatgcgctcgagagaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33483907 |
atccaaatccttacaatccacaactttatggaatacaaagaaaaaataagacggcaaatgttatcaacctaaaacagactaggatatgcgctcgagagaa |
33483808 |
T |
 |
| Q |
104 |
gcatgataagaattcctaaatccaaaacatcatttggaacctagagataggtcttgtctaggtcatcaaagtaagggtgttccatag |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33483807 |
gcatgataagaattcctaaatccaaaacatcatttggaacctagagataggtcttgtctaggtcatcaaagtaagggtgttccatag |
33483721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University