View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5016_low_4 (Length: 343)
Name: NF5016_low_4
Description: NF5016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5016_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 150 - 334
Target Start/End: Original strand, 33484305 - 33484492
Alignment:
| Q |
150 |
ttggttacgaaattggatttctaacaaaactgttgattgattggagatgttgtggcttgtgtgtttggaagcgttgcctttgttgatctcaagttctagt |
249 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33484305 |
ttggttacgaatttgggtttctaacaaaactgttgattgattggagatgttgtggcttgtgtgattggaagcgttacctttgttgatctcaagttctagt |
33484404 |
T |
 |
| Q |
250 |
ttg---tcattgtgagttcattgatctcgaatatgatcaactctagttgagaaaatttaagtgggnnnnnnngaacaaagttgatgat |
334 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33484405 |
ttgatttcattgtgagttcattgatctcgaatatgatcaactctagttgagaaaatttaagtgggaaaaaaagaacaaagttgatgat |
33484492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 14 - 143
Target Start/End: Original strand, 33484138 - 33484267
Alignment:
| Q |
14 |
agaagtaaaatggtgagcagtaaaatttgctttcactgtaataattgggagggaattgaaaatgtggatttcacagaaaatgacttttccaactcagcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
33484138 |
agaagtaaaatggtgagcagtaaaatttgctttcactgtaataattgggagggaattgaaaatgtggatttcacagtaaatgacttttccaactcaacaa |
33484237 |
T |
 |
| Q |
114 |
tttaattagctctcaaatctgtgagtcatc |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33484238 |
tttaattagctctcaaatctgtgagtcatc |
33484267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University