View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5017-Insertion-14 (Length: 173)
Name: NF5017-Insertion-14
Description: NF5017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5017-Insertion-14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 4e-83; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 2462084 - 2461929
Alignment:
| Q |
7 |
agattctgtgtctccatcacgtcaatgttcctccatttctgggacaaaatttattggcaccccattgggatactgttgcatcaccaaaacagatgctgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2462084 |
agattctgtgtctccatcacgtcaatgttcctccatttctgggacaaaatttattggcaccccattgggatactgttgcatcaccaaaacagatgctgtt |
2461985 |
T |
|
| Q |
107 |
gtccgaaaatcttgtgatgccaataagccaccaacaggtcctaattccgggcactc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2461984 |
gtccgaaaatcttgtgatgccaataagccaccaacaggtcctaattccgggcactc |
2461929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 2451074 - 2450919
Alignment:
| Q |
7 |
agattctgtgtctccatcacgtcaatgttcctccatttctgggacaaaatttattggcaccccattgggatactgttgcatcaccaaaacagatgctgtt |
106 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2451074 |
agattccgtgtctccatcacgtgaatgttcctccatttctgggacaaagtttattggcaccccattgtgatactgttgcatcaccaaaacagatgctgtt |
2450975 |
T |
|
| Q |
107 |
gtccgaaaatcttgtgatgccaataagccaccaacaggtcctaattccgggcactc |
162 |
Q |
| |
|
|| || ||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
2450974 |
gtgcggaaatcttgtgatgccaacaagccaccaacaggtcctaattctgggcactc |
2450919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 82; E-Value: 5e-39
Query Start/End: Original strand, 30 - 163
Target Start/End: Complemental strand, 2446284 - 2446151
Alignment:
| Q |
30 |
aatgttcctccatttctgggacaaaatttattggcaccccattgggatactgttgcatcaccaaaacagatgctgttgtccgaaaatcttgtgatgccaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||| | ||||||| ||| ||| |
|
|
| T |
2446284 |
aatgttcctccatttctgggacaaaattcattggcaccccattatgatactgttgcatcaccaaaaccgatgctgttgtggggcaatcttgggatatcaa |
2446185 |
T |
|
| Q |
130 |
taagccaccaacaggtcctaattccgggcactcc |
163 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
2446184 |
caagccaccaacaggtcctagttccgggcactcc |
2446151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University