View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5017_high_15 (Length: 257)
Name: NF5017_high_15
Description: NF5017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5017_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 6423880 - 6424122
Alignment:
| Q |
1 |
aaccttttgcattcccaacttttatccatttatgttgaaacaaatataacataaacacaacaagagtactcatagaccaaatgggctcacaacaatgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6423880 |
aaccttttgcattcccaacttttatccatttatgttgaaacaaacataacataaacacaacaagagtactcatagaccaaatgggctcacaacaatgaac |
6423979 |
T |
 |
| Q |
101 |
actgtctaaacattcttcattagtccttcaaccttcacttgcttcttattcttcttcatggggggtcgttgctctaaattctctttctgttggttccact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6423980 |
actgtctaaacattcttcattagtccttcaaccttcacttgcttcttattcttcttcatggggggtcgttgctctaaattctctttctgttggttccact |
6424079 |
T |
 |
| Q |
201 |
ctcacctcaatccttctgttcttgaatcctctgaccaaggttt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6424080 |
ctcacctcaatccttctgttcttgaatcctctgaccaaggttt |
6424122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University